Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04403

HP ID(1) HP04403
Gene ID(2) 6992
Gene Symbol finder PPP1R11
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 11
RefSeq NM_021959.2
Length of RefSeq (bp) 1664
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.82887

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi44D08 pGCAP10 GAGGGGTGGAGAAGCGGAGGCCCAGGAGGAGGGGGAATAAAGAAGGTGGAGGATCCTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl