Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04396

HP ID(1) HP04396
Gene ID(2) 219902
Gene Symbol finder TMEM136
Protein Name transmembrane protein 136
RefSeq NM_174926.1
Length of RefSeq (bp) 922
Chromosome 11q23.3
Reference DDBJ accession
UniGene Hs.706896

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa34A10 pKA1U5 GCCTGTTGCCGCGATCCGGGCCGGGAGCTGCGGGCGCCCGGGCGCCCGAGGCTTCCCGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl