Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04391

HP ID(1) HP04391
Gene ID(2) 221294
Gene Symbol finder NT5DC1
Protein Name 5'-nucleotidase domain containing 1
RefSeq NM_152729.2
Length of RefSeq (bp) 3193
Chromosome 6q22.1
Reference DDBJ accession
UniGene Hs.716499

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa33G05 pKA1U5 GCCCGCGCAGCCATGGCTCAGCACTTCTCCCTGGCCGCCTGCGACGTGGTCGGATTCGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl