Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04389

HP ID(1) HP04389
Gene ID(2) 55006
Gene Symbol finder TRMT61B
Protein Name tRNA methyltransferase 61 homolog B (S. cerevisiae)
RefSeq NM_017910.3
Length of RefSeq (bp) 1856
Chromosome 2p23.2
Reference DDBJ accession
UniGene Hs.468026

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa33E10 pKA1U5 ATCCTGTTGGCCTTCGCGAAACACTATGCTAATGGCATGGNTGCCGCGGTCCTGTCTTGC
RBd02C03 pGCAP10 GGTCTGCGACGGCGCCTTCGCGAAACACTATGCTAATGGCATGGTGCCGCGGTCCTGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl