Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04380

HP ID(1) HP04380
Gene ID(2) 9616
Gene Symbol finder RNF7
Protein Name ring finger protein 7
RefSeq NM_014245.3
Length of RefSeq (bp) 1599
Chromosome 3q22-q24
Reference DDBJ accession
UniGene Hs.134623

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe77H02 pKA1U5 GGGCTCCGCGGCGCCGCCATGGCCGACGTGGCACCANTNGAGAGGAAACCTGCGCCCTGG
ARe87E01 pKA1U5 GGGCTCCGCGGCGCCGCCATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCC
RBd39A04 pGCAP10 GGCGGCGCCGCCATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCAC
RBdS081P01 pGCAP10 GGCCGCCATGGCCGACGTGNAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl