Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04377

HP ID(1) HP04377
Gene ID(2) 123803
Gene Symbol finder NTAN1
Protein Name N-terminal asparagine amidase
RefSeq NM_173474.2
Length of RefSeq (bp) 1137
Chromosome 16p13.11
Reference DDBJ accession
UniGene Hs.592045

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe54B06 pKA1U5 GGGGCAGGACGAGGCGGGTACGCGCGGCCCGAGGGGCGGGGGCGGCGGGCGGCCCGGGGC
RBdS132C05 pGCAP10 GGCAGGACGAGGCGGGACGCGCGGCCCGAGGGGCGGGGGCGGCGGGCGGCCCGGGGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl