Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04373

HP ID(1) HP04373
Gene ID(2) 4879
Gene Symbol finder NPPB
Protein Name natriuretic peptide precursor B
RefSeq NM_002521.2
Length of RefSeq (bp) 708
Chromosome 1p36.2
Reference DDBJ accession
UniGene Hs.219140

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04G04 pKA1U5 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARe17G04 pKA1U5 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARe33G04 pKA1U5 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARe41C05 pKA1U5 GAGGCCCGACACTCAGCTCCAGGATAAAAGGCCACGGTTGNTCCCGAGGAGCCAGGAGGA
ARe59F03 pKA1U5 TGAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGC
ARe64C12 pKA1U5 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGCTGGGAAGCAAACCCGGACGCATCGCAGC
ARe65F10 pKA1U5 GATGAGCACCCCGTCAGGCGTGAGGGCAGGGTGGNAANNAAACCCGGTACGCATCGCAAC
ARe70E01 pKA1U5 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGCNATNAAAACCCGGACGCATCGCAGCA
ARe80C06 pKA1U5 AGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAG
ARe80H09 pKA1U5 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARe97H08 pKA1U5 ATCCTGGAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATC
ARf04C08 pKA1U5 ATGAGGACNACCCTGGTGACAGCTNGANNTGAAGAGGCGAATNNAAGCCNTNCNCGTCCC
ARf05B03 pKA1U5 TGAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGC
ARi05F07 pGCAP10 GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
ARi08F05 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi11D08 pGCAP10 GTCTGGCTGCTTTGGGAGGAAGATGGACCGGATCAGCTCCTCCAGTGGCCTGGGCTGCAA
ARi18C02 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi35C09 pGCAP10 GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
ARi40H10 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi45B12 pGCAP10 GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
ARi45F05 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi56E05 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi59B11 pGCAP10 GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
ARi69H06 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi70B02 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARi70H01 pGCAP10 GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
ARiS008G06 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARiS020G06 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARiS055D17 pGCAP10 GAGGAGGANCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACNCATCNCANCA
ARiS055E01 pGCAP10 GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
ARiS087A18 pGCAP10 GNGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
ARiS087M11 pGCAP10 GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
ARiS088F05 pGCAP10 GGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGC
ARiS096J10 pGCAP10 GAGGAGGNNCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARiS118P16 pGCAP10 GAGGAGCTNCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
ARiS194L18 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARiS194P20 pGCAP10 GAGGANNANCNCCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA
ARiS198B09 pGCAP10
ARiS198D04 pGCAP10 GAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCA
ARiS198J09 pGCAP10 GAGGAGGAGCACCCCGCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl