Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04356

HP ID(1) HP04356
Gene ID(2) 26471
Gene Symbol finder NUPR1
Protein Name nuclear protein 1
RefSeq NM_012385.2
Length of RefSeq (bp) 884
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.513463

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43H11 pKA1U5 GGCCAGGAAAGCAGAGACAGACAAAGCGTTAGGAGAAGAAGAGAGGCAGGGAAGACAAGC
ARi24G09 pGCAP10 GGCCAGGAAAGCAGAGACAGACAAAGCGTTAGGAGAAGAAGAGAGGCAGGGAAGACAAGC
ARi67B11 pGCAP10 GATAAGCTGAGGGAGTGGAGAGGCCCGGGGCCAGGAAAGCAGAGACAGACAAAGCGTTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl