Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04354

HP ID(1) HP04354
Gene ID(2) 55069
Gene Symbol finder C7orf42
Protein Name chromosome 7 open reading frame 42
RefSeq NM_017994.4
Length of RefSeq (bp) 4238
Chromosome 7q11.21
Reference DDBJ accession
UniGene Hs.488478

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi34F01 pGCAP10 TCCCGGAAACCGCGGTTGCCGGAGCCCGAACTGAGGCGGCGGCGGGAGCCCGGTTGGCGT
RBd88C05 pGCAP10 CGGCCGGCCGATGACCCGGAAACCGCGGTTGCCGGAGCCCGAACTGAGGCGGCGGCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl