Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04350

HP ID(1) HP04350
Gene ID(2) 7057
Gene Symbol finder THBS1
Protein Name thrombospondin 1
RefSeq NM_003246.2
Length of RefSeq (bp) 5820
Chromosome 15q15
Reference DDBJ accession
UniGene Hs.164226

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe50F05 pKA1U5 GAGCCGCTGCGCCCGAGCTGGCCTGCGAGTTCAGGGCTCCTGTCGCTCTCCAGGAGCAAC
ARiS013F01 pGCAP10 GAGCCGCTGCGCCCGAGCTGGCCTGCGAGTTCAGGGCTCCTGTCGCTCTCCAGGAGCAAC
ARiS020F12 pGCAP10 GAGCCNNTGCGCCCGAGCTGGCCTGCGAGTTCAGGGCTCCTGTCGCTCTCCAGGAGCAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl