Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04344

HP ID(1) HP04344
Gene ID(2) 196051
Gene Symbol finder PPAPDC1A
Protein Name phosphatidic acid phosphatase type 2 domain containing 1A
RefSeq NM_001030059.1
Length of RefSeq (bp) 1521
Chromosome 10q26.12
Reference DDBJ accession
UniGene Hs.40479

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14E02 pKA1U5 GGCGGGTGCCCGGCNCGGGCCCAGGAGGCGGAGGCGGCTCCTGGGGAGAGGGATCCGGGA
ARe82G02 pKA1U5 GGGGCCCAGGAAGGCGGAGGCGGCTCCTGGGGAGAGGGATCCGGGAGTCCCTGAGGCGGC
ARe97B03 pKA1U5 GGTGCCCGGCGCGGGCCCAGGAGGCGGAGGCGGCTCCTGGGGAGAGGGATCCGGGAGTCC
ARi24D09 pGCAP10 GGCGCCTCCCTCGCCTCCCAGGGTCTGGCGAGCCGGCGCCGGCCGAGCTGCGGGAGCCGC
ARi62G06 pGCAP10 TGCGGAGCACCAGCTGACGCCGCGGGAGCTGCTCCGGCCGCACCATGCGGGAGCTGGCCA
ARi62G07 pGCAP10 TGCGGAGCACCAGCTGACGCCGCGGGAGCTGCTCCGGCCGCACCATGCGGGAGCTGGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl