Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04319

HP ID(1) HP04319
Gene ID(2) 112970
Gene Symbol finder KTI12
Protein Name KTI12 homolog, chromatin associated (S. cerevisiae)
RefSeq NM_138417.2
Length of RefSeq (bp) 1712
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.476033

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21B06 pKA1U5 GAGTTGGCGCAGCGCGGTTGCCAATGGTCGCTCCCTGAGAGGATGCCGCTCGTGGTGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl