Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04314

HP ID(1) HP04314
Gene ID(2) 7088
Gene Symbol finder TLE1
Protein Name transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
RefSeq NM_005077.3
Length of RefSeq (bp) 3283
Chromosome 9q21.32
Reference DDBJ accession
UniGene Hs.197320

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb35D10 pGCAP1 GAGCAGCAGAAACAGCGGCGGGTACTCTGTGCCCCGCGTCCCGGAGGCAGCCGACTGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl