Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04311

HP ID(1) HP04311
Gene ID(2) 29087
Gene Symbol finder THYN1
Protein Name thymocyte nuclear protein 1
RefSeq NM_014174.2
Length of RefSeq (bp) 1323
Chromosome 11q25
Reference DDBJ accession
UniGene Hs.13645

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39H01 pKA1U5 GACAGCCTGCGGCGCAGCGGAGGCGGACCGCAGCTCGAGTCTGCAGAGTGTTGGGTCTGT
ARe39H03 pKA1U5 GACAGCCTGCGGCGCAGCGGAGGCGGACCGCANTTCGANATCTGCAGAGTGTTGGGTCTG
ARe42H12 pKA1U5 GGCACAGCCTGCGGCGCAGCGGAGGCGGACCGCAGTTCGAGTCTGCAGAGTGTTGGGTCT
ARiS085A07 pGCAP10 GGCACAGCCTGCGGCGCAGCGGAGGCGGACCGCAGTCGAGTCTGCAGAGTGTTGGGTCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl