Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04301

HP ID(1) HP04301
Gene ID(2) 5824
Gene Symbol finder PEX19
Protein Name peroxisomal biogenesis factor 19
RefSeq NM_002857.3
Length of RefSeq (bp) 3722
Chromosome 1q23.2
Reference DDBJ accession
UniGene Hs.517232

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa22D07 pKA1U5 GGTAGCAAGATGGCCCGCCGCTGAGGAAGGCTGTAGTGTCGGGGCCGAAGCGGACAGGGA
RBdS014C04 pGCAP10 GGGTAGCAAGATGGCCGCCGCTGAGGAAGGCTGTAGTGTCGGGGCCGAAGCGGACAGGGA
RBdS177E10 pGCAP10 GAGCAAGATGGCCGCCGCTGAGGAAGGCTGTAGTGTCGGGGCCGAAGCGGACAGGGAATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl