Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04300

HP ID(1) HP04300
Gene ID(2) 23585
Gene Symbol finder TMEM50A
Protein Name transmembrane protein 50A
RefSeq NM_014313.2
Length of RefSeq (bp) 2284
Chromosome 1p36.11
Reference DDBJ accession
UniGene Hs.523054

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02B10 pKA1U5 GACTGCTGCATCCGGGTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGCTAAAATCGGG
ARe17F08 pKA1U5 GACTGCTGCATCCGGGTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGCTAAAATCGGG
ARe56D07 pKA1U5 GGAGCCGGGTGGATGGTACTGCTGCATCCGGGCGTCTGGAGGCTGTGGCCGTTTTGTTTT
ARe83E03 pKA1U5 GACTGCTGCATCCGGGTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGCTAAAATCGGG
ARiS023G20 pGCAP10 GAGGAGAAGGCGACGGCGTCCAGACCCCGCCAAGACGGAGAGGGGACCGCGCCCTCCCCC
ARiS198O20 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl