Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04291

HP ID(1) HP04291
Gene ID(2) 11212
Gene Symbol finder PROSC
Protein Name proline synthetase co-transcribed homolog (bacterial)?
RefSeq NM_007198.3
Length of RefSeq (bp) 2586
Chromosome 8p11.2
Reference DDBJ accession
UniGene Hs.304792

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa21G07 pKA1U5 GGTCGGTCCCCGGGGGATGTGGAGAGCTGGCAGCATGTCGGCCGAGCTGGGAGTCGGGTG
RBd54B06 pGCAP10 GGGCAGCATGTCGGCCGAGCTGGGAGTCGGGTGCGCATTGCGGGCGGTGAACGAGCGCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl