Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04273

HP ID(1) HP04273
Gene ID(2) 79863
Gene Symbol finder C18orf22
Protein Name chromosome 18 open reading frame 22
RefSeq NM_024805.2
Length of RefSeq (bp) 5697
Chromosome 18q23
Reference DDBJ accession
UniGene Hs.593610

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARb00A02 pKA1U5 GCTCCCGCTCTGCGCCGTCGCCCCGTCCACACGCCGCCACCCTCGCGTCAGTTGTCGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl