Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04269

HP ID(1) HP04269
Gene ID(2) 113220
Gene Symbol finder KIF12
Protein Name kinesin family member 12
RefSeq NM_138424.1
Length of RefSeq (bp) 2024
Chromosome 9q32
Reference DDBJ accession
UniGene Hs.28149

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd51F10 pGCAP10 GACCCGCGCCAGGTGAGTCCTCCAGGCGGGGGTCCAGAAGTGGCGTTCCGCTTCGGTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl