Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04251

HP ID(1) HP04251
Gene ID(2) 27183
Gene Symbol finder VPS4A
Protein Name vacuolar protein sorting 4 homolog A (S. cerevisiae)
RefSeq NM_013245.2
Length of RefSeq (bp) 2211
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.128420

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43C07 pKA1U5 GGGACTCGGCTCCCGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGCCCACCG
ARiS045P11 pGCAP10 GGCCCTCNGACTCGGCTCCCGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGC
RBb04B10 pKA1U5 GGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGCCCACCGCCGGGCTTCCCGC
RBd23H06 pGCAP10 TGGGCACCGCGCTCAGCGCCCACCGCCGGGCTTCCCGCGCCGGACCCAGTACCTCGGCTC
RBd50F04 pGCAP10 GACCGCCGGGCTTCCCGCGCCGGACCCAGTACCTCGGCTCCCGGGGCCGGACCGAGGCCG
RBdS132L22 pGCAP10 GGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGCCCACCGCCGGGCTTCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl