Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04244

HP ID(1) HP04244
Gene ID(2) 10458
Gene Symbol finder BAIAP2
Protein Name BAI1-associated protein 2
RefSeq NM_006340.1
Length of RefSeq (bp) 2129
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.128316

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd47E04 pGCAP10 GGGTTCGGGTCCGCTTTCGTCTCCGTCCTGCTGCCGTTACCGCCGCTGCTGCCGCCGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl