Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04243

HP ID(1) HP04243
Gene ID(2) 5264
Gene Symbol finder PHYH
Protein Name phytanoyl-CoA 2-hydroxylase
RefSeq NM_006214.3
Length of RefSeq (bp) 1620
Chromosome 10p13
Reference DDBJ accession
UniGene Hs.498732

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb01A12 pKA1U5 GGACGGTGCCCTCCCGGGCAGGAGCTGGCCAGGCAGGCGCTGCCCAGGGCGGCCTCCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl