Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04228

HP ID(1) HP04228
Gene ID(2) 80896
Gene Symbol finder NPL
Protein Name N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
RefSeq NM_030769.1
Length of RefSeq (bp) 1552
Chromosome 1q25
Reference DDBJ accession
UniGene Hs.496969

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd80B10 pGCAP10 GGGAGCGGCTGCACGGACAAGAGCGGAGGCCTGGAAGGGGAAACTGAAGCAGAAAGAGGT
RBdS070D08 pGCAP10 GGGAGCGGCTGCACGGACAAGAGCGGAGGCCTGGGTGAGCGCGGCCCGCGACGGCACGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl