Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04217

HP ID(1) HP04217
Gene ID(2) 10404
Gene Symbol finder PGCP
Protein Name plasma glutamate carboxypeptidase
RefSeq NM_016134.2
Length of RefSeq (bp) 1928
Chromosome 8q22.2
Reference DDBJ accession
UniGene Hs.156178

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi76C01 pGCAP10 GAGGGGGGTGACCTCCGGCGCCGCAGGGGTAGGGGATCTCCTTTTACCGGGGATCCACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl