Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04192

HP ID(1) HP04192
Gene ID(2) 10040
Gene Symbol finder TOM1L1
Protein Name target of myb1 (chicken)-like 1
RefSeq NM_005486.2
Length of RefSeq (bp) 2356
Chromosome 17q23.2
Reference DDBJ accession
UniGene Hs.153504

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS020P14 pGCAP10 GGGCGCTACCATGGCGTTTGGCAAGAGTCACCGGGATCCCTACGCGACCTCCGTGGGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl