Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04180

HP ID(1) HP04180
Gene ID(2) 5195
Gene Symbol finder PEX14
Protein Name peroxisomal biogenesis factor 14
RefSeq NM_004565.2
Length of RefSeq (bp) 1945
Chromosome 1p36.22
Reference DDBJ accession
UniGene Hs.149983

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083C06 pGCAP10 GAGGCCTCAGAAAGATGGCGTCCTCGGAGCAGGCAGAGCAGCCGAGCCAGCCAAGCTCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl