Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04177

HP ID(1) HP04177
Gene ID(2) 4682
Gene Symbol finder NUBP1
Protein Name nucleotide binding protein 1 (MinD homolog, E. coli)
RefSeq NM_002484.2
Length of RefSeq (bp) 1265
Chromosome 16p13.13
Reference DDBJ accession
UniGene Hs.81469

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe98E12 pKA1U5 GGGCAAAGGCGACGGAATGGAGGAGGTGCCTCACGACTGTCCAGGGGCCGACAGCGCCCA
RBd36D08 pGCAP10 GGTTCCGGTGACCACGAAGGCGGCAAAGGCGACGGAATGGAGGAGGTGCCTCACGACTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl