Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04169

HP ID(1) HP04169
Gene ID(2) 51399
Gene Symbol finder TRAPPC4
Protein Name trafficking protein particle complex 4
RefSeq NM_016146.4
Length of RefSeq (bp) 1216
Chromosome 11q23.3
Reference DDBJ accession
UniGene Hs.132760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi09A06 pGCAP10 GAGTTTCCGAGCGGCAAGGCAGCGATGGCGATTTTTAGTGTGTATGTGGTGAACAAAGCT
ARi20F09 pGCAP10 GGAGCGGCAAGGCAGCGATGGCGATTTTTAGTGTGTATGTGGTGAACAAAGCTGGCGGCT
RBb15E08 pKA1U5 TGGAATACCAGTTTCCGAGCGGCAAGGCAGCGATGGCGATTTTTAGTGTGTATGTGGTGA
RBd50F05 pGCAP10 GGAATACCAGTTTCCGAGCGGCAAGGCAGCGATGGCGATTTTTAGTGTGTATGTGGTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl