Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04161

HP ID(1) HP04161
Gene ID(2) 27295
Gene Symbol finder PDLIM3
Protein Name PDZ and LIM domain 3
RefSeq NM_014476.3
Length of RefSeq (bp) 1830
Chromosome 4q35
Reference DDBJ accession
UniGene Hs.85862

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa59F04 pKA1U5 GGGGCGGGAGGAAGGCGGCATGCCCCAGACGGTGATCCTCCCGGGCCCTGCGCCCTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl