Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04142

HP ID(1) HP04142
Gene ID(2) 79035
Gene Symbol finder OBFC2B
Protein Name oligonucleotide/oligosaccharide-binding fold containing 2B
RefSeq NM_024068.3
Length of RefSeq (bp) 1404
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.240170

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb46D09 pGCAP1
RBd70H02 pGCAP10 GAGCGGCGTGCACAGTCCTGCCGGCTGGCTTGGTGGGGTGCCGAGGCTCAGGCAGCATGA
RBdS083P06 pGCAP10 GGCACTCCCGCGTTCCACGGGGCAGCATCCGGCGGCAGCGGAGCCTGTGGCTCCCCCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl