Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04125

HP ID(1) HP04125
Gene ID(2) 11030
Gene Symbol finder RBPMS
Protein Name RNA binding protein with multiple splicing
RefSeq NM_006867.2
Length of RefSeq (bp) 3154
Chromosome 8p12-p11
Reference DDBJ accession
UniGene Hs.334587

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe60E03 pKA1U5 GGCGCCCCGCTCCCTCCGGGCTGCAGCCGGCAGCCCACNTTCCAGGGAGGGCGGAGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl