Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04116

HP ID(1) HP04116
Gene ID(2) 11104
Gene Symbol finder KATNA1
Protein Name katanin p60 (ATPase-containing) subunit A 1
RefSeq NM_007044.2
Length of RefSeq (bp) 1532
Chromosome 6q25.1
Reference DDBJ accession
UniGene Hs.450175

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70H10 pKA1U5 GAGTTCGCCGAGGTCGTCCCCGGCACCGGAAGTGACCCTGGCGGGTTTGTCTTCAAATTC
RBd33A12 pGCAP10 GGGAAGTGACCCTGGCGGGTTTGTCTTCAAATTCTCGGCGAGCAGGAGCCGCGCCGGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl