Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04081

HP ID(1) HP04081
Gene ID(2) 23588
Gene Symbol finder KLHDC2
Protein Name kelch domain containing 2
RefSeq NM_014315.2
Length of RefSeq (bp) 1808
Chromosome 14q21.3
Reference DDBJ accession
UniGene Hs.719215

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb04A01 pKA1U5 GGCAGACGGGCTGCAAGAGGGAGCCGGCCCGACGCGGACCGCTTCCCTGCAGTGCCCCGA
RBd47D03 pGCAP10 GCTGCATCGACTCTAAGGCGAGACCAGAAACTTGCTAGTGGAGCAATTCTGGTGCCCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl