Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04067

HP ID(1) HP04067
Gene ID(2) 5252
Gene Symbol finder PHF1
Protein Name PHD finger protein 1
RefSeq NM_002636.3
Length of RefSeq (bp) 2008
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.166204

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe77B06 pKA1U5 GCCCGGCCTCCGCCTGCACGCCCCCCCACGCCCGGATGTTGCCCTCTCCGCGCGGGGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl