Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04021

HP ID(1) HP04021
Gene ID(2) 7105
Gene Symbol finder TSPAN6
Protein Name tetraspanin 6
RefSeq NM_003270.2
Length of RefSeq (bp) 2069
Chromosome Xq22
Reference DDBJ accession
UniGene Hs.43233

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53E04 pKA1U5 GGTCTCGGGCTAGTCATGGCGTCCCCGNTCTCGGAGACTGCAGACTAAACCAGTCATTAC
ARiS087F12 pGCAP10 GAATCGCCCGGTGCGGTGGTGCAGGGTCTCGGGCTAGTCATGGCGTCCCCGTCTCGGAGA
RBdS013P20 pGCAP10 GGGTGGTGCAGGGTCTCGGGCTAGTCATGGCGTCCCCGTCTCGGAGACTGCAGACTAAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl