Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03987

HP ID(1) HP03987
Gene ID(2) 5127
Gene Symbol finder PCTK1
Protein Name PCTAIRE protein kinase 1
RefSeq NM_006201.3
Length of RefSeq (bp) 3130
Chromosome Xp11.3-p11.23
Reference DDBJ accession
UniGene Hs.496068

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS055F01 pGCAP10 GGCGCGGCGCGCGCGGCGGTTGGGCCGTTGGCTGTTCGGCCCTGGGATCCGCCGCCACTC
RBb18F09 pKA1U5 GGGCCCTGGGATCCGCCGCCACTCCGCGATCAGACCNTNTCTGTGCCGCGAGCCGCCGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl