Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03973

HP ID(1) HP03973
Gene ID(2) 54987
Gene Symbol finder C1orf123
Protein Name chromosome 1 open reading frame 123
RefSeq NM_017887.1
Length of RefSeq (bp) 1118
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.525391

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd49D09 pGCAP10 GAAGGGCCGCACCCAGCACCGGGCGGAGAGGGCTACCATGGGGAAAATCGCGCTGCAACT
RBdS154M11 pGCAP10 GGCAGCCAGCACCGGGCGGAGAGGGCTACCATGGGGAAAATCGCGCTGCAACTCAAAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl