Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03965

HP ID(1) HP03965
Gene ID(2) 23587
Gene Symbol finder C17orf81
Protein Name chromosome 17 open reading frame 81
RefSeq NM_015362.3
Length of RefSeq (bp) 1398
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.417029

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe77A10 pKA1U5 GAGGGACCGGACGCGAGTTGGAGATGTTGGACCCTTTGATTGGCCTTGGGCGGCCTGGTG
ARi28E03 pGCAP10 GCTTGGGCGGCCTGGTGCTGCTTCGGGATTCCGTGGAGTGGGAGGGGCGCAGTCTCTTGA
RBd71F06 pGCAP10 GATCAGAGGGCGCCAGAGCAGGGACCGGACGCGAGTTGGAGATGTTGGACTCGCTGTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl