Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03960

HP ID(1) HP03960
Gene ID(2) 55753
Gene Symbol finder OGDHL
Protein Name oxoglutarate dehydrogenase-like
RefSeq NM_018245.1
Length of RefSeq (bp) 3682
Chromosome 10q11.23
Reference DDBJ accession
UniGene Hs.17860

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd77D08 pGCAP10 GGCGCAGCCCCCTGACCTGCAGCCTCCGGACCTCGCTGCAGCGCGGACCCGGCCCGCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl