Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03950

HP ID(1) HP03950
Gene ID(2) 29919
Gene Symbol finder C18orf8
Protein Name chromosome 18 open reading frame 8
RefSeq NM_013326.3
Length of RefSeq (bp) 2173
Chromosome 18q11.2
Reference DDBJ accession
UniGene Hs.464779

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe27G04 pKA1U5 GGCAGCCGCCGCTACAGTCCGGGCCGGGCTCCACCGCGCATCCTGCTCCACTCTGGCGAC
ARi49C01 pGCAP10 GGGACTGCGCGGAACATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGG
ARi57D09 pGCAP10 GGGACTGCGCGGAACATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGG
ARi61A08 pGCAP10 GGGACTGCGCGGAACATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGG
RBb26G08 pGCAP1 GGTGGGCGGGGATGGGGGCGTGGCACCAGGTAAGCGGCGTCCGCNCCGGGCCCAGAGCCG
RBd31E08 pGCAP10 GTCGGACTGCGCGGAACATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGT
RBd47C04 pGCAP10 GAGAGCCGCAGCCGCAGCCGCCGCTACAGTCCGGGCCGGGCTCCACCGCGCATCCTGCTC
RBd78H06 pGCAP10 TTGAGCCGCAGCCGCCGCTACAGTCCGGGCCGGGCTCCACCGCGCATCCTGCTCCACTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl