Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03894

HP ID(1) HP03894
Gene ID(2) 8799
Gene Symbol finder PEX11B
Protein Name peroxisomal biogenesis factor 11B
RefSeq NM_003846.1
Length of RefSeq (bp) 1610
Chromosome 1q21.1
Reference DDBJ accession
UniGene Hs.504284

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb64D12 pGCAP1 GGCGGGAGCAGGGCCGCGGAGCCTGGGCTGCGGCTGTCATGGACGCCTGGGTCCGCTTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl