Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03855

HP ID(1) HP03855
Gene ID(2) 9577
Gene Symbol finder BRE
Protein Name brain and reproductive organ-expressed (TNFRSF1A modulator)
RefSeq NM_004899.3
Length of RefSeq (bp) 1893
Chromosome 2p23.2
Reference DDBJ accession
UniGene Hs.258314

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS087N11 pGCAP10 GACTTCCAGTTTGGAGTCGTTTGCTGCGGGGAGGGAATGAATGGGCGCTGGGAACACGCC
ARiS198E23 pGCAP10
RBb61B12 pGCAP1 GGTCGGGGGCGCGCTCGGGTACCTGTACCCCACGTAGTCGCCGGTTACCGATCGGACTAA
RBd41C12 pGCAP10 GATCCTGCCCGCGGCGCGCGCGCAGGTCGGTGCGTCTGTCGGGGGCGCGCTCGGGTACCT
RBdS013B10 pGCAP10 GGCGCACGCATCCTGCCCGCGGCGCGCGCGCAGGTCGGTGCGTCTGTCGGGGGCGCGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl