Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03547

HP ID(1) HP03547
Gene ID(2) 1200
Gene Symbol finder TPP1
Protein Name tripeptidyl peptidase I
RefSeq NM_000391.3
Length of RefSeq (bp) 3540
Chromosome 11p15
Reference DDBJ accession
UniGene Hs.523454

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe40A01 pKA1U5 AGAATGGGACTCCAAGCCTGCCTCCTAGGGCTCTTTGCCCTCATCCTCTCTGGCAAATGC
ARi62F09 pGCAP10 GAGATCCGCGGANGGACACAGTGGAACTCCTACCCTGCCTCATAGGGCTCATTNNNCTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl