Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03501

HP ID(1) HP03501
Gene ID(2) 26502
Gene Symbol finder NARF
Protein Name nuclear prelamin A recognition factor
RefSeq NM_001038618.2
Length of RefSeq (bp) 1796
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.256526

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi04G05 pGCAP10 GGACAACAAAGGGCCGCGGGCGGCGGGCAGTGGTGTCCCAGTCTCCCGGTGCTTCCCTGA
RBd80G09 pGCAP10 GGTCCCAGTCTCCCGGTGCTTCCCTGAGGCTGAGGCGCCCGGCCTCCCGCCCGCCGCGCT
RBd89C02 pGCAP10 GGTCCCAGTCTCCCGGTGCTTCCCTGAGGCTGAGGCGCCCGGCCTCCCGCCCGCCGCGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl