Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03454

HP ID(1) HP03454
Gene ID(2) 57215
Gene Symbol finder THAP11
Protein Name THAP domain containing 11
RefSeq NM_020457.2
Length of RefSeq (bp) 1903
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.632200

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi42G12 pGCAP10 GGGGGGCCCACTCCCGAGCGCAGGCGGGCAGCCAGGCGGGCGGCGCGGCGCGGGCCGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl