Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03400

HP ID(1) HP03400
Gene ID(2) 8459
Gene Symbol finder TPST2
Protein Name tyrosylprotein sulfotransferase 2
RefSeq NM_003595.3
Length of RefSeq (bp) 1910
Chromosome 22q12.1
Reference DDBJ accession
UniGene Hs.632768

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb68C08 pGCAP1 GGGAGAGCCGGGAGTCGCTGGGTGCGTGGGGCTGCCTCGCCGCGTCTCGCCACGGGCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl