Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03393

HP ID(1) HP03393
Gene ID(2) 553115
Gene Symbol finder PEF1
Protein Name penta-EF-hand domain containing 1
RefSeq NM_012392.2
Length of RefSeq (bp) 1640
Chromosome 1p34
Reference DDBJ accession
UniGene Hs.470417

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132K03 pGCAP10 GAGAATCACCATGGCCAGCTATCCTTACCGGCAGGGCTGCCCAGGAGCTGCAGGACAAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl