Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03356

HP ID(1) HP03356
Gene ID(2) 669
Gene Symbol finder BPGM
Protein Name 2,3-bisphosphoglycerate mutase
RefSeq NM_001724.3
Length of RefSeq (bp) 1769
Chromosome 7q31-q34
Reference DDBJ accession
UniGene Hs.198365

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb03H06 pKA1U5 GGGCTAGAAAAGAGCGTCGATGCCGGCGGCAGTGATGAGTCCTAGGAGGCGCTGGCTCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl