Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03262

HP ID(1) HP03262
Gene ID(2) 7072
Gene Symbol finder TIA1
Protein Name TIA1 cytotoxic granule-associated RNA binding protein
RefSeq NM_022037.2
Length of RefSeq (bp) 4620
Chromosome 2p13
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd13C03 pGCAP10 GAAAACGATTTGGGAGGTAGTGAAGGGCAGGGAGCTGGACCTGGAGGCGCCGCCGCGACA
RBd15H11 pGCAP10 GATTGGGGTTTCATTGTTCCCGCTGGGCCGGGCGGTTTAGTGTAATTGCCGCCGGAGGAG
RBd93D01 pGCAP10 GGCCGCCATCTTGTATTGGGGTTTCATTGTTCCCGCTGGGCCGGGCGGTTTATTGTAATT
RBdS187L14 pGCAP10 GATCTGTGAGCCCGCGGAGTATACACCATGAGCAAAGCTCACCCTCCCGAGTTGAAAAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl