Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03186

HP ID(1) HP03186
Gene ID(2) 6876
Gene Symbol finder TAGLN
Protein Name transgelin
RefSeq NM_003186.3
Length of RefSeq (bp) 1177
Chromosome 11q23.2
Reference DDBJ accession
UniGene Hs.410977

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05F04 pKA1U5 GACTCCTTCCTGCGAGCCCTGAGGAAGCCTTCTTTCCCCAGACATGGCCAACAAGGGTCC
ARe12H01 pKA1U5 ATCCTGCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGA
ARe21B05 pKA1U5 ATCCTGGGCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAG
ARe22B11 pKA1U5 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACCTCCTTCCTGCGAGCCCTGAGGAAGCC
ARe24F07 pKA1U5 GCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCC
ARe31F07 pKA1U5 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACATCCTTCCTGCGAGCCCTGAGGAA
ARe32G07 pKA1U5 TGCCTGTCTGTCCGAACCCAGACACAAGTCTTCACCTCCTTTCCTGCGAGCCCTGAGGAA
ARe34D09 pKA1U5 GATCATCCTGNTCTGTCCGAACCCAGACACAAGTCTTCACATCCTTCCTGCGAGCCCTGA
ARe35G04 pKA1U5 GGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTNCTGCGAGCCCTGAGGAAGCCTTC
ARe49A06 pKA1U5 GCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCC
ARe53A01 pKA1U5 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARe56F07 pKA1U5 GCTGTCTGTCCGAACCCAGTACACAAGNTCTTCACNCCTTAAATGCGAGCCCTGAGGAAG
ARe67A09 pKA1U5 GCCTGTCTGTCCGAACCCAGACACAAGTCTTCACATCCTTCCTGCGAGCCCTGAGGAAGC
ARe72E05 pKA1U5 GCCTGNTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGC
ARe78A01 pKA1U5 GGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCTTC
ARe78F01 pKA1U5 GATCCTGGTCTGNTCCGAACCCAGCACACAAGTCCTTCACGTCCATTCCTGCGAGCCCTG
ARe81H02 pKA1U5 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARe88F11 pKA1U5 GGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCTTC
ARe93C03 pKA1U5 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAG
ARe94A08 pKA1U5 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAG
ARe97H03 pKA1U5 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARf02E08 pKA1U5 GACTCCTTCCTGCGAGCCCTGAGGAAGCCTTCTTTCCCCAGACATGGCCAACAAGGGTCC
ARf06A05 pKA1U5 GATCCTGCTCTGNTCCGAACCCANAACACAAGGTCNTCNCTTCCTTCCTGCGAGCCCTGA
ARi13C01 pGCAP10 GACTCCTTCCTGCGAGCCCTGAGGAAGCCTTCTTTCCCCAGACATGGCCAACAAGGGTCC
ARi17B10 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARi28F11 pGCAP10 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAG
ARi37H12 pGCAP10 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAG
ARi38D11 pGCAP10 GCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCC
ARi41F08 pGCAP10 GGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCTTC
ARi41H06 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARi47B08 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARi47D11 pGCAP10 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAG
ARi51E05 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARi55F05 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARi66D05 pGCAP10 GCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCC
ARi69B12 pGCAP10 GGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCTTC
ARi70C05 pGCAP10 GATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAG
ARiS008M16 pGCAP10 GCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCC
ARiS013M11 pGCAP10 GCCTTCCTGCGAGCCCNNAGGAAGCCTTCTTTCCCCAGACATGGCCAACAAGGGTCCTTC
ARiS045O07 pGCAP10 GGTCTTCACTCCTTCNTGCNAGCCCTGAGGAAGCCTTCTTTCCCCAGACATGGCCAACAA
ARiS085F16 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT
ARiS118N08 pGCAP10 GCGCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGC
ARiS122O19 pGCAP10 GGCNANCCNNTGNNGNAGGCTGACATCACCACNGCNGCAGCCCTTTAAACCCCTCACCCA
ARiS191F21 pGCAP10 GCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCCTGCGAGCCCTGAGGAAGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl